View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_high_8 (Length: 262)
Name: NF2963_high_8
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 3592224 - 3592036
Alignment:
| Q |
1 |
aactaagaaacatgccattaccaataccaaactcttcattattaccttctgattgatctttggtactgattagaatctgtggtggcaaaaaagatggtgg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3592224 |
aactcagaaacatgccattaccaataccaaactcttcattattaccttctgattgatctttggtactgattagattctgtggtggcaaaaaagatggtgg |
3592125 |
T |
 |
| Q |
101 |
atgaataagagattcatgcatagaagaaggtgtgnnnnnnnnattcagcctattggcatttgaggtggtggtggaggaggtgctaatag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3592124 |
atgaataagagattcatgcatagaagaaggtgtgttttttttattcagcctattggcatttgaggtggtggtgaaggaggtgctaatag |
3592036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 174 - 246
Target Start/End: Complemental strand, 3592027 - 3591955
Alignment:
| Q |
174 |
gaggaggtgctaatagaggttgatatcttgactctcttattcttcctaacaccaccaacaggaacattcctta |
246 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592027 |
gaggtggtgctaatagaggttgatatcttgactctcttattcttcctaacaccaccaacaggaacattcctta |
3591955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University