View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_low_11 (Length: 250)
Name: NF2963_low_11
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_low_11 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 135 - 250
Target Start/End: Complemental strand, 5665016 - 5664901
Alignment:
| Q |
135 |
tttcttgaggattacaattaatggtttttgtcaatcgtaaaagcatgtacattatacaagatataatcatcgaaacccatcacgattaaaccaggaataa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5665016 |
tttcttgaggattacaattaatggtttttgtcaatcataaaagcatgtacattatacaagatataatcatcgaaacccatcacgattaaactaggaataa |
5664917 |
T |
 |
| Q |
235 |
aaatttacagcaacat |
250 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5664916 |
aaatttacagcaacat |
5664901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 5665165 - 5665054
Alignment:
| Q |
13 |
aaaatgcataaaaaatgtttaagtgggaatggtagttttacatacatgaatgagttaaatataagatggaaattttttgatggaaaatgaaggaaacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5665165 |
aaaatgcataaaaaatgtttaagtgggaatggtaattttacatacatgaatgagttaaatataagatggaaattttttgatggaaaacgaaggaaacatt |
5665066 |
T |
 |
| Q |
113 |
gtcaacgaatag |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5665065 |
gtcaacgaatag |
5665054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University