View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_low_16 (Length: 225)
Name: NF2963_low_16
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 51715344 - 51715217
Alignment:
| Q |
18 |
tattttacagtgcaattagatgtacaactcagtatagacatgttcctgtaaaaccattttcatacaagtagtttattatacatcnnnnnnntccaagtag |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
51715344 |
tattttacagtgcaattagatgcacaacttagtatagacatgttcctgtaaaaccattttcatacaattagtttattatacatcaaaaaaatccaagtag |
51715245 |
T |
 |
| Q |
118 |
tttattggtaagcaattgtatttgtagt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51715244 |
tttattggtaagcaattgtatttgtagt |
51715217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 51715153 - 51715104
Alignment:
| Q |
163 |
gaactgagtaccccgaaaattgcctataatcaataaatgctcattcatct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51715153 |
gaactgagtaccccgaaaattgcctataatcaataaatgctcattcatct |
51715104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University