View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_low_4 (Length: 406)
Name: NF2963_low_4
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 17 - 398
Target Start/End: Complemental strand, 32505855 - 32505474
Alignment:
| Q |
17 |
caagttctacaacccgacgcaaacagcgtccgtgaaactctcgctaattcaaaacccaaaagtaccctcacacgtcttgtttcttcttactttgatcaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505855 |
caagttctacaacccgacgcaaacagcgtccgtgaaactctcgctaattcaaaacccaaaagtaccctcacacgtcttgtttcttcttactttgatcaca |
32505756 |
T |
|
| Q |
117 |
gtgaaaccgcttcacatctttgtctaattctctttcgcactgttaatcgtgctcgtgaaatgtataaccctgtctttgatctcatatctgttcttcctgc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505755 |
gtgaaaccacttcacatctttgtctaattctctttcgcaccgttaatcgtgctcgtgaaatgtataaccctgtctttgatctcatatctgttcttcctgc |
32505656 |
T |
|
| Q |
217 |
agactgttcttcactatctcaaccgcaatgtgacactgcttatgatcttttcgtcgaatttaacgttcatgaaaatccgtttattttccctcattttaat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505655 |
agactgttcttcactatctcaaccgcaatgtgacactgcttatgatcttttcgtcgaatttaacgttcatgaaaatccgtttattttccctcattttaat |
32505556 |
T |
|
| Q |
317 |
accctgcggaatagtttctccgatttgaaacatgaaattcagctcgataggcgtaaatgccggcatagaattcgttcatttc |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
32505555 |
accctgcggaatagtttctccgatttgaaacatgaaattcagctcgataggcgtaaatgccagcatagaattcgtttatttc |
32505474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University