View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_24 (Length: 425)
Name: NF2964_high_24
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 16 - 407
Target Start/End: Original strand, 1836972 - 1837372
Alignment:
| Q |
16 |
cagagatggcagcggctgcatacgacgtagctgccttgcatttcaggggacgtgaagccaggctcaatttcccggaacttgcaaacactcttcctcgtcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1836972 |
cagagatggcagcggctgcatacgacgtagctgccttgcatttcaggggacgtgaagccaggctcaatttcccggaacttgcaaacactcttcctcgtcc |
1837071 |
T |
|
| Q |
116 |
tctaagcaacaatgctgaccacattcgaatggcagcacatgaagccgccttgaggttgagagccaaca------tgttggcgccaccagataacaacagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
1837072 |
tctaagcaacaatgctgaccacattcgaatggcagcacatgaagccgccttgaggttgagagccaacaccaacatgttggcgccactagataacaacagt |
1837171 |
T |
|
| Q |
210 |
ggaacaggct---cagccagttccactgatgcggtggcgcctctgagggtcagactctctccaagtcaaattcaagcgattaatgattcgcctatggatt |
306 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1837172 |
ggaacaggctgctcagccagttccactgatgcggtggcgcctctgagggtcagactctctccaagtcaaattcaagcgattaacgattcgcctatggatt |
1837271 |
T |
|
| Q |
307 |
ctcctcctacatggatgcaaatgtcacacccctttatgatggatgatcaaaccatgttatatggtaatggctatgaatttgaagaaaatgaatgggaaga |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1837272 |
ctcctcctacatggatgcaaatgtcacacccctttatgatggatgatcaaaacatgttatatggtaatggctatgaatttgaagaaaatgaatgggaaga |
1837371 |
T |
|
| Q |
407 |
c |
407 |
Q |
| |
|
| |
|
|
| T |
1837372 |
c |
1837372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University