View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_36 (Length: 382)
Name: NF2964_high_36
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 13 - 337
Target Start/End: Complemental strand, 24735888 - 24735561
Alignment:
| Q |
13 |
aatatcccaaaaccatgctat---caaccattccatcccatcatagattgtgtactcaatatgtgcccttgcatgttttgctaattcaccctttgggatc |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24735888 |
aatatcccaaaaccatgctatgatcaaccattccatcccatcatagattgtgtactcaatatgtgcccttgcatgttttgctaattcaccctttgggatc |
24735789 |
T |
|
| Q |
110 |
tgcatctgcttcaaaatagactgctccaaggtttaagatgtggaaaccaaacattggttcaaatttgcccaagagagatgttgtaaagaagatagtagca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24735788 |
tgcatctgcttcaaaatagactgctccaaggtttaagatgtggaaaccaaacattggttcaaatttggccaagagagatgttgtaaagaagatagtagca |
24735689 |
T |
|
| Q |
210 |
ccatgaacaaccccctgtataatccaaatgttaaaatttatttttatttcttttgcgccttgcctaacccagttttgcaggactaagaatcgttctctga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24735688 |
ccatgaacaaccccctgtataatccaaatgttaaaatttatttttatttcttttgcgccttgcctaacccagttttgcaggactaagaatcgttctctga |
24735589 |
T |
|
| Q |
310 |
gaactgtcatgacctccagctacatatc |
337 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
24735588 |
gaattgtcatgacctccagctacatatc |
24735561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 33329228 - 33329166
Alignment:
| Q |
13 |
aatatcccaaaaccatgctatcaaccattccatcccatcatagattgtgtactcaatatgtgc |
75 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||| | || |||||| ||||||| |
|
|
| T |
33329228 |
aataacccaaaaccaacctatcaactattccatcccatcatagttagtatactcagtatgtgc |
33329166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University