View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_51 (Length: 312)
Name: NF2964_high_51
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 4608961 - 4609142
Alignment:
| Q |
1 |
caacagaacaaacatgcaattgctgttgcagctgctacggcggccgctgcggatgctgctgtggccgccgcgcaggctgccgtggcagttgtgaggttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
4608961 |
caacagaacaaacatgcaattgctgttgcagctgctacggcggccgctgctgatgctgctgtggccgccgcacaggctgccgtggcagttgtgaggctga |
4609060 |
T |
|
| Q |
101 |
caagtcaaggtagaggtacattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609061 |
caagtcaaggtagaggtacattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
4609142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University