View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_56 (Length: 303)
Name: NF2964_high_56
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 114 - 283
Target Start/End: Complemental strand, 54229844 - 54229677
Alignment:
| Q |
114 |
gaattggaaatcccatgcgtgtttggtctgtaagagtgagtgagtgatggacgttttgattcttgggggnnnnnnnnnnnnnnnnnnnnnnggagcttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54229844 |
gaattggaaatcccatgcgtgtttggtttgtaagagtgagtgagtgatggacgttttgattcttggggg---gtagtagtagtactagtagggagcttat |
54229748 |
T |
 |
| Q |
214 |
tattcacatgttctctcgctctctcgctccatc-ttgttgtatttgttctgccttcaccacagacacacag |
283 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229747 |
tattcacatgttctctcgctctatcgcaccatctttgttgtatttgttctgccttcaccacagacacacag |
54229677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University