View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_61 (Length: 279)
Name: NF2964_high_61
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_61 |
 |  |
|
| [»] scaffold0651 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 33521182 - 33521438
Alignment:
| Q |
19 |
attcctatcctacaactccccatctggtgagcagatgcatacatattccaagcttcttgatgtgacattggtccttctgctgcgtaaaccgattccacga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521182 |
attcctatcctacaactccccatctggtgagcagatgcatacatattccaagtttcttgatgtgacattggtccttctgctgcgtaaaccgattccacga |
33521281 |
T |
 |
| Q |
119 |
acttattcaattccatttcattagttccactacaaacaattctctgtccatcacttctgtgagtacctacctcaactgctccagctgctataagtatcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521282 |
acttattcaattccatttcattagttccactacaaacaattctctgtccatcacttctgtgagtacctacctcaactgctccagctgctataagtatcct |
33521381 |
T |
 |
| Q |
219 |
cagcgcccgctgaagtccgtgcttcatgttctctttgtcgaattcttcatctcactc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33521382 |
cagcgcccgctgaagtccgtgcttcatgttctctttgtcgaattcttcatctaactc |
33521438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 31321644 - 31321591
Alignment:
| Q |
156 |
aattctctgtccatcacttctgtgagtacctacctcaactgctccagctgctat |
209 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
31321644 |
aattctctgaccatcacttctgtgtgttcctacttcaactgctcctgctgctat |
31321591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 31333897 - 31333844
Alignment:
| Q |
156 |
aattctctgtccatcacttctgtgagtacctacctcaactgctccagctgctat |
209 |
Q |
| |
|
||||||||| ||| |||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
31333897 |
aattctctgaccaccacttctgtgtgttcctacttcaactgctcctgctgctat |
31333844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0651
Description:
Target: scaffold0651; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 2027 - 2080
Alignment:
| Q |
156 |
aattctctgtccatcacttctgtgagtacctacctcaactgctccagctgctat |
209 |
Q |
| |
|
||||||||| ||| |||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
2027 |
aattctctgaccaccacttctgtgtgttcctacttcaactgctcctgctgctat |
2080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University