View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_62 (Length: 277)
Name: NF2964_high_62
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 115 - 273
Target Start/End: Complemental strand, 37022879 - 37022721
Alignment:
| Q |
115 |
ggaattgtttttggatacttagttttgagattgagaatgaggatgacaacgttgttgttttaaagggtggttttttgagaaagggcatgatttgttgtgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37022879 |
ggaattgtttttggatacttagttttgagattgagaatgaggatgacaacgttgttgttttaaagggtggttttttgagaaagggcatgatttgttgtgt |
37022780 |
T |
 |
| Q |
215 |
tatttacaacgttgtccttggtctaattccacgtcaaagtgacccttgatgatgtccat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
37022779 |
tatttacaacgttgtccttggtctaattccacgtcaaagtgacccttgattatgaccat |
37022721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37022986 - 37022933
Alignment:
| Q |
1 |
tttttgattctgggtttctccggtccggtgatgctttctccctctaaaaatgtt |
54 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37022986 |
tttttgattctgggtttctcctgtccggtgatgcttcctccctctaaaaatgtt |
37022933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University