View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_75 (Length: 218)
Name: NF2964_high_75
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_75 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 5665287 - 5665496
Alignment:
| Q |
1 |
gattttgatcttgagcttggacgaattgtagtgtttaccggtgttttctataatgaacttgaagtggttgttgagaagaagactg---------gtttta |
91 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5665287 |
gattttggtcttgaacttagacgaattgtagtatttatcggtgttttctataatgaacttgaagtggttgttgagaagaagactgactggccgtgtttta |
5665386 |
T |
|
| Q |
92 |
gtcatggatggcgtgaaagaagaccatgttgatcaggtctgttgacggtgttgagccaactacaattgaagatgaggttgcgcaaggatcatctaacaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665387 |
ctcatggatggcgtgaaagaagaccatgttga---ggtctgttgacggtgttgagccaaccacaattgaagatgaggttgcgcaaggatcatctaacaaa |
5665483 |
T |
|
| Q |
192 |
cctaccaaattga |
204 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5665484 |
cctaccaaattga |
5665496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University