View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_high_78 (Length: 207)
Name: NF2964_high_78
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_high_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 2327908 - 2327736
Alignment:
| Q |
20 |
ggtagataatgaacttgtaaccatttgtgtaccctaaaaatcaccacacaaatttaccnnnnnnn-agagagaatcatcctacttctttacccaatgttt |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2327908 |
ggtagataatgaacttataaccatttgtgtaccctaaaaaccatcacacaaatttacattttttttagagagaatcatcctacttctttacccaatgttt |
2327809 |
T |
|
| Q |
119 |
tttatgcagtaaacgannnnnnnaagccaaacctattataactgtacacacactattaagcaatagttgacac |
191 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327808 |
tttatgcagtgatcgatttttttaagccaaacctattataactgtacacacactattaagcaatagttgacac |
2327736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University