View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2964_low_64 (Length: 277)

Name: NF2964_low_64
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2964_low_64
NF2964_low_64
[»] chr4 (2 HSPs)
chr4 (115-273)||(37022721-37022879)
chr4 (1-54)||(37022933-37022986)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 115 - 273
Target Start/End: Complemental strand, 37022879 - 37022721
Alignment:
115 ggaattgtttttggatacttagttttgagattgagaatgaggatgacaacgttgttgttttaaagggtggttttttgagaaagggcatgatttgttgtgt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37022879 ggaattgtttttggatacttagttttgagattgagaatgaggatgacaacgttgttgttttaaagggtggttttttgagaaagggcatgatttgttgtgt 37022780  T
215 tatttacaacgttgtccttggtctaattccacgtcaaagtgacccttgatgatgtccat 273  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
37022779 tatttacaacgttgtccttggtctaattccacgtcaaagtgacccttgattatgaccat 37022721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37022986 - 37022933
Alignment:
1 tttttgattctgggtttctccggtccggtgatgctttctccctctaaaaatgtt 54  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
37022986 tttttgattctgggtttctcctgtccggtgatgcttcctccctctaaaaatgtt 37022933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University