View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_low_65 (Length: 276)
Name: NF2964_low_65
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 33521642 - 33521910
Alignment:
| Q |
1 |
ctttgtgtacagaagttattattcctccctcatagcttttacc-ttgagatcagacattgtgtctggaaaatgtccccacgtcattagcacgggatgaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33521642 |
ctttgtgtacagaagttattattcctccctcatagcttttacccttgagatcagacattgtgtctggaaaatgtccccacgtcattagcaccggatgaag |
33521741 |
T |
 |
| Q |
100 |
atgaaagtgtcagccgatattcttattctttaatccactagagatcattaaaggtggcgtggaaagtgctccacatgatgagattgttgctttggcctca |
199 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521742 |
atgaaggtgtcggccgatattcttattctttaatccactagagatcattaaaggtggcgtggaaagtgctccacatgatgagattgttgctttggcctca |
33521841 |
T |
 |
| Q |
200 |
acatgaattttccatgtgatgttttctgttaaaacatttgccataactcctaaacatttctttcttctc |
268 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521842 |
acttgaattttctatgtgatgttttctgttaaaacatttgccataactcctaaacatttctttcttctc |
33521910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University