View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2964_low_70 (Length: 247)
Name: NF2964_low_70
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2964_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38663277 - 38663042
Alignment:
| Q |
1 |
gtgcttcggatggggagttcttgaacccaccgggtgtaggagattatggagattatgtggattggcgttccactgtaaatgcttcaagagagtcgattac |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38663277 |
gtgcttcggattgggagttcttgaacccaccgggtgtaggagattatggagattatgtggattggcgttccactgtaaatgcttcaagagagtcgattac |
38663178 |
T |
|
| Q |
101 |
ttttgcttaag---ttgctggagaaggtctcaccgccggagaagggggtgtgtatcggagtttcaagaacaacgatgcttccaacaagttcaatactttc |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38663177 |
ttttgcttaagaagttgctggagaaggtctcaccgccggagaaggtggtgtgtatcggagtttcaagaacaacgatgcttccaacaagttcaatactttc |
38663078 |
T |
|
| Q |
198 |
gccggaaattctggttgcggttgtgtttgttgtgga |
233 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38663077 |
gccggaaattctggttgcggttgcgtttgttgtgga |
38663042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University