View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2964_low_77 (Length: 226)

Name: NF2964_low_77
Description: NF2964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2964_low_77
NF2964_low_77
[»] chr2 (1 HSPs)
chr2 (6-89)||(4443657-4443740)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 6 - 89
Target Start/End: Original strand, 4443657 - 4443740
Alignment:
6 agagatcgtcttaagtatttacttgtttaaaaggaatttcatatactaattacctaatatacttacagaaatgtactatgttct 89  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||    
4443657 agagatcgttttaaatatttacttgtttaaaaggaatttcatatactaattacctaatatacttacaaaaatgaattatgttct 4443740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University