View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2965_low_6 (Length: 249)
Name: NF2965_low_6
Description: NF2965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2965_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 27 - 233
Target Start/End: Original strand, 54879915 - 54880121
Alignment:
| Q |
27 |
tttatttcaatgactcatttgttcaatataatgtgatatttgaccacacagcatgtatagttctgtttctgtcnnnnnnntaaacacggagcgtgtagta |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54879915 |
tttatttcaatgactcatttgttcaatataatgtgatatttgaccacacagcatgtatagttctgtttctgtcaaaaaaataaacacggagcgtgtagta |
54880014 |
T |
 |
| Q |
127 |
ttttaactctagactagacaacctaaattctgtatataatgagtacctcatgctatgtcccctccgaaaataaatttcttgcagcacaattaattataga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880015 |
ttttaactctagactagacaacctaaattctgtatataatgagtacctcatgctatgtcccctccgaaaataaatttcttgcagcacaattaattataga |
54880114 |
T |
 |
| Q |
227 |
cctaagt |
233 |
Q |
| |
|
||||||| |
|
|
| T |
54880115 |
cctaagt |
54880121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University