View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966-Insertion-18 (Length: 420)
Name: NF2966-Insertion-18
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966-Insertion-18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 405; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 8 - 420
Target Start/End: Original strand, 13452324 - 13452736
Alignment:
| Q |
8 |
ataccttcctgcattacctctctttcttcgttaagaattcttgacctcaccggaaacaaaatctccggcaacattcccggcaatattggaaagcttcagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452324 |
ataccttcctgcattacctctctttcttcgctaagaattcttgacctcaccggaaacaaaatctccggcaacattcccggcaatattggaaagcttcagc |
13452423 |
T |
|
| Q |
108 |
atcttactgttttgaatcttgctgataatgcaatctccggtgagattccgatgtcgattgtgagaatctctggtctcatgcatcttgacctcgccggaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452424 |
atcttactgttttgaatcttgctgataatgcaatctccggtgagattccgatgtcgattgtgagaatctctggtctcatgcatcttgacctcgccggaaa |
13452523 |
T |
|
| Q |
208 |
ccaaatctccggtgagttaccttccgatataggaaaactccgaagactaagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452524 |
ccaaatctccggtgagttaccttccgatataggaaaactccgaagactgagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcg |
13452623 |
T |
|
| Q |
308 |
gttttgaaaatgaaccggcttgcggatttggatttatctatgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452624 |
gttttgaaaatgaaccggcttgcggatttggatttatctatgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactt |
13452723 |
T |
|
| Q |
408 |
tgaaacttgatgg |
420 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13452724 |
tgaaacttgatgg |
13452736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University