View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966-Insertion-19 (Length: 480)
Name: NF2966-Insertion-19
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966-Insertion-19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 8 - 480
Target Start/End: Complemental strand, 24294024 - 24293551
Alignment:
| Q |
8 |
ctataaagcaatattcctttataggaccttgattttgaccgatcgggagttacgatatgataaatccagccgtgtttgagcaacgtaagggccccataaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24294024 |
ctataaagcaatattcctttataggaccttgattttgaccgatcgagagttacgatatgataaatccagcagtgtttgagcaacgtaagggccccataaa |
24293925 |
T |
|
| Q |
108 |
gcaatattcctttttaggaccttaaatgtgtgctttaggaagaatactactttataaacccctcacattgctgaaatcctctaggatttattagatcata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
24293924 |
gcaatattcctttttaggaccttaaatgtgcgctttaggaagaatactactttataaaaccctcacattgctcaaatcctctaggatttattagatcgta |
24293825 |
T |
|
| Q |
208 |
actttcgagatagagcaaaatctaccgggagttacgaatcaatcgatttttaaa-atctgaccataactcccaatcgacttgttttcataggctgagcaa |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24293824 |
actttcgagatagagcaaaatctaccgggagttacgaatcaatcgttttttttttatctgaccataactcccaatcgacttgttttcataggctgagcaa |
24293725 |
T |
|
| Q |
307 |
tgcgaggggcggatagagcaattctccttaggcctccgtggtttgggtcattttgctcagttctagttgtgttgtaatgcacatgttcttggtctctatt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24293724 |
tgcgaggggcggatagagcaattctccttaggcctccgtggtttgggtcattttgctcacttctagttgtgttgtaatgcacatgttcttggtctctatt |
24293625 |
T |
|
| Q |
407 |
gtttggttatttttctccatggatcttatttgttgctacatctcgttttcaccattagaatgtgggatctttga |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24293624 |
gtttggttatttttctccatggatcttatttgttgctacatctcgttttcaccattagaatgtgggatctttga |
24293551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University