View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966-Insertion-35 (Length: 89)
Name: NF2966-Insertion-35
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966-Insertion-35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 41268542 - 41268461
Alignment:
| Q |
8 |
gtaaaacctttgtaaaagttcatagacttgaactttgaacttggccagtagccaggtgaaggtggccaataagcattgcttg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41268542 |
gtaaaacctttgtaaaagttcatagacttgaactttgaacttggccagtagccaggtgaaggtggccaataagcattgcttg |
41268461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 27686113 - 27686190
Alignment:
| Q |
12 |
aacctttgtaaaagttcatagacttgaactttgaacttggccagtagccaggtgaaggtggccaataagcattgcttg |
89 |
Q |
| |
|
|||| ||||||||| |||||||| ||| || |||||||||||||| || || |||||||||||||| |||||||||| |
|
|
| T |
27686113 |
aaccattgtaaaagctcatagacctgactttggaacttggccagtaaccgggggaaggtggccaataggcattgcttg |
27686190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University