View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966R-Insertion-8 (Length: 233)
Name: NF2966R-Insertion-8
Description: NF2966R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966R-Insertion-8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 28129527 - 28129751
Alignment:
| Q |
9 |
cttttgtcgatgattaatctctgtagtggattctctccactcaacatgttttcattcagagcgttcaaacccgagactttattttagagattaagagaga |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129527 |
cttttgtcgatgattaaactctgtagtggattctctccactcaacatgttttcattcagagcgttcaaacccgagactttattttagagattaagagaga |
28129626 |
T |
|
| Q |
109 |
gtgaagtgatgagtactaaccaatgcaaatccacctctagcgcaccaagtttttggcatggtggtagaacgagcgccataccactctgggagactagttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129627 |
gtgaagtgatgagtactaaccaatgcaaatccacctctagcgcaccaagtttttggcatggtggtagaacgagcgccataccactctgggagactagttt |
28129726 |
T |
|
| Q |
209 |
tccccagaataatggcaccagcatc |
233 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28129727 |
tccccagaataatggcaccagcatc |
28129751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 233
Target Start/End: Original strand, 28114076 - 28114216
Alignment:
| Q |
100 |
taagagagagtga-agtgatgagtacta---accaatgcaaatccacctctagcgcaccaagtttttg---gcatggtggtagaacgagcgccataccac |
192 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| ||||||||||||||| |||||||| || | |||| | | ||||||| ||||||||| |
|
|
| T |
28114076 |
taagagagagtgatagtgatgagtactactaaccaagccaaatccacctctagggcaccaagcttgtcctagcatttttgaagaacgaatcccataccac |
28114175 |
T |
|
| Q |
193 |
tctgggagactagttttccccagaataatggcaccagcatc |
233 |
Q |
| |
|
||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
28114176 |
tctggaagactagttttccccagaatgatagcaccagcatc |
28114216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University