View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_high_28 (Length: 241)
Name: NF2966_high_28
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 3861767 - 3861540
Alignment:
| Q |
4 |
atgagttgcaaaaacttgaaaccaagtccaatgtttccattgtttgcacatgcggctataactgaattccaagaaataacatccttgtcagctatatcag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3861767 |
atgagttgcaaaaacttgaaaccaagtccaatgtttccattgtttgcacatgcggctataactgaattccaagaaataacatccttgtcagctatatcag |
3861668 |
T |
 |
| Q |
104 |
agaatatccgaacagcacgttcaacagatccgcatttgccatacatatcaatcaagcagttagcaacaacagtattattatccattcctaatttcactgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3861667 |
agaatatccgaacagcacgttcaacagatccgcatttgccatacatatcaatcaagcagttagcaacaacagtattattatccattcctaatttcactgt |
3861568 |
T |
 |
| Q |
204 |
cttggaatgaattgaactaccaagtttc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3861567 |
cttggaatgaattgaactaccaagtttc |
3861540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University