View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_high_29 (Length: 238)
Name: NF2966_high_29
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 30348185 - 30348030
Alignment:
| Q |
1 |
cagagatacaaccagctgagaaaggaagaataacaagcctttccattctctgtctcattctttcttaggataggtgaatatctcaattggaa-ttggagc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
30348185 |
cagagatacaaccagctgagaaaggaagaatgacaagcctttccattctctgtctcattatttcttaggaaaggtgaatatctcaattggaatttggagc |
30348086 |
T |
 |
| Q |
100 |
ttaattaattgatccaccaaaaaatgcaacccttgaatggagatataacaactaca |
155 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348085 |
tgaattaattgatccaccaaaaaatgcaacccttgaatggagatataacaactaca |
30348030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University