View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_high_33 (Length: 218)
Name: NF2966_high_33
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 51268326 - 51268133
Alignment:
| Q |
14 |
cagagagtttaatgcagtaattaatctcacccattgatttaagattggttgatctttttt-attaaacaaagattggttgatctaaattaaacaaataat |
112 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51268326 |
cagagagtttaatagagtaattgatctcacccattgatttaagattggttgatctttttttattaaacaaagattggttgatctaaattaaacaaataat |
51268227 |
T |
|
| Q |
113 |
ttcatgcagttaaatgatatcgtccgttgatttagatcgaacagctgaaaattgtaactgtgtgacatcgtttgaactatatatgtatgctttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51268226 |
ttcatgcagttaaatgatatcgtccgttgatttagatcgaacagctgaaaattgtaactgcgtgacatcgtttgaactatatatgtatgctttg |
51268133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 83 - 206
Target Start/End: Complemental strand, 23306358 - 23306235
Alignment:
| Q |
83 |
agattggttgatctaaattaaacaaataatttcatgcagttaaatgatatcgtccgttgatttagatcgaacagctgaaaattgtaactgtgtgacatcg |
182 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||||||||||||||||| | | ||||||||||| ||||||| |||| || || ||||| |||||||| |
|
|
| T |
23306358 |
agattggatgatctaaatcaaacaaacaatttcatgcagttaaatgatcttgcccgttgatttatatcgaacggctggaagttataactatgtgacattt |
23306259 |
T |
|
| Q |
183 |
tttgaactatatatgtatgctttg |
206 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
23306258 |
tttgagctatatatgtatgctttg |
23306235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 68
Target Start/End: Complemental strand, 23306399 - 23306345
Alignment:
| Q |
14 |
cagagagtttaatgcagtaattaatctcacccattgatttaagattggttgatct |
68 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||||||||||| ||||||| |||||| |
|
|
| T |
23306399 |
cagagagtttcatgcagtaattgatcccacccattgatttgagattggatgatct |
23306345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University