View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_high_4 (Length: 416)
Name: NF2966_high_4
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 219 - 371
Target Start/End: Original strand, 38014260 - 38014412
Alignment:
| Q |
219 |
caacatactcacaatttgtccacaaaaaacagagaatatattcaaattgctagtcgacaacccaaatacaaggttgcttataagcataacacagtagtgc |
318 |
Q |
| |
|
|||||||||||| | | |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
38014260 |
caacatactcacgaatagtccacaaaatacagagaatatattcaaattgctagtcgagaacccaaatacaaggttgcttataagcataacactgaagtga |
38014359 |
T |
 |
| Q |
319 |
tggtacacattaaaataattccacaaagctatccaaattaccaacttgtcatt |
371 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38014360 |
tggtacacattaaaatacttccacaaagctatccaaattaccaacctgtcatt |
38014412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University