View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_23 (Length: 283)
Name: NF2966_low_23
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 100 - 242
Target Start/End: Original strand, 39687321 - 39687463
Alignment:
| Q |
100 |
agacacgtataaggtaataagtactaacgaatatcttgatgtgccgtcattgataggcagaagtaaacatgctacatataatttcaagttttttaaggat |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39687321 |
agacacgtataaggtactaagtactaacaaatatcttgatgtgccgtcattgataggcagtagtaaacatgctacatatactttcaagttttttaaggat |
39687420 |
T |
 |
| Q |
200 |
tagatttggagtaagatcaactcataagccaaccttcttatgg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39687421 |
tagatttggagtaagatcaactcataagccaaccgtcttatgg |
39687463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 39679593 - 39679697
Alignment:
| Q |
1 |
tcatgtttgtttaaaagtccctcaatttaccagaactattttgtagtcgtaacacataagataattttcgaaacctcatttgctaacaatctatgtgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39679593 |
tcatgtttgtttaaaagtccctcaatttaccagaactattttgtagtcgtaacacataagataattttcgaaacctcatttgctaacaatctatgtgtta |
39679692 |
T |
 |
| Q |
101 |
gacac |
105 |
Q |
| |
|
||||| |
|
|
| T |
39679693 |
gacac |
39679697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University