View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_28 (Length: 252)
Name: NF2966_low_28
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 24064223 - 24063987
Alignment:
| Q |
18 |
agtatagtccttgaattcttaaaattggagtaaattaccaatttaatcattgaaattataggattgtgtgatttaatccctaaaattgataatcatcat- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24064223 |
agtatagtccttgaattcttaaaattggagtaaattaccaatttaatcattgaaattataggattgagtgatttaatccctaaaattgataatcatcatc |
24064124 |
T |
 |
| Q |
117 |
--tcacatcaattatttgagttcaaatcttggtgaaacaatctttgaatcaccaaagcttcatttctttaagaacaaaagttttaagacaaaaaacaaaa |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24064123 |
attcacatcaattctttgagttcaaatcttggtgaaacaatctttgaatcaccaaagcttcattcctttaagaacaaaaggtttaagacaaaaaacaaaa |
24064024 |
T |
 |
| Q |
215 |
gagaactcattaagggttggtctggtggtgttgacttg |
252 |
Q |
| |
|
||||||||| | ||||||||| || ||||||||||||| |
|
|
| T |
24064023 |
gagaactcact-agggttggtttgatggtgttgacttg |
24063987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University