View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_29 (Length: 250)
Name: NF2966_low_29
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 87 - 241
Target Start/End: Complemental strand, 53636530 - 53636375
Alignment:
| Q |
87 |
gcctaaattcaaagacaacatcctattttt-gagtaaatcacattttgtgcatttcattcaatgttaattgttagggagnnnnnnnnnnnnnnnnnntac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53636530 |
gcctaaattcaaagacaacatcctattttttgagtaaatcacattttgtgcatttcattcaatgttaattgttagggagaaaaaaagaaaagaaaaatac |
53636431 |
T |
 |
| Q |
186 |
ataaacggaccttatactatgatgtgacgctttatatactaatctcagtgtcacat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53636430 |
ataaacggaccttatactatgatgtgacgctttatatactaatctcagtgtcacat |
53636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 53636574 - 53636531
Alignment:
| Q |
22 |
agagggtcaatgggtatttgggtagcactcccatcagtaccagc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53636574 |
agagggtcaatgggtatttgggtagcactcccatcagtaccagc |
53636531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 22 - 148
Target Start/End: Original strand, 48333547 - 48333670
Alignment:
| Q |
22 |
agagggtcaatgggtatttgggtagcactcccatcagtaccagcagagaggcgttaaaagactttgcctaaattcaaagacaacatcctatttttgagta |
121 |
Q |
| |
|
|||||| ||||||||||||||| || || || |||||||||||||||||| ||| ||||||||||||||||| ||| |||| ||||||| ||||||| |
|
|
| T |
48333547 |
agagggccaatgggtatttgggcagtacccctatcagtaccagcagagagaagtt-aaagactttgcctaaatccaaggacatcatccta--attgagta |
48333643 |
T |
 |
| Q |
122 |
aatcacattttgtgcatttcattcaat |
148 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
48333644 |
aaccacattttgtgcatttcattcaat |
48333670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 48335440 - 48335497
Alignment:
| Q |
183 |
tacataaacggaccttatactatgatgtgacgctttatatactaatctcagtgtcacat |
241 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
48335440 |
tacataaatgggccttatactatgatgtgacgctttat-tactaatttcagtgtcacat |
48335497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 48335569 - 48335626
Alignment:
| Q |
183 |
tacataaacggaccttatactatgatgtgacgctttatatactaatctcagtgtcacat |
241 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
48335569 |
tacataaatgggccttatactatgatgtgacgctttat-tactaatttcagtgtcacat |
48335626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University