View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_3 (Length: 653)
Name: NF2966_low_3
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 37918971 - 37918642
Alignment:
| Q |
1 |
ctccaatcatcttccatccagctctccctcataacannnnnnnnnnnnnnnnnatgtatttactcaaatgaatactatatggttatattgatattcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37918971 |
ctccaatcatcttccatccagctctccctcataacattttattttttaattttatgtatttactcaaatgaatactatatggttatattgatattcttct |
37918872 |
T |
|
| Q |
101 |
acccatttatgcaaccacatgctccttgct---------gcacacacttcc-----actcaaagtttgtttcacttcttctcttaacccataaacaaaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37918871 |
acccatttatgcaaccacatgctccttgctacgttggcagcacacacttccgatccactcaaagtttgtttcacttcttctcttaacccataaacaaaaa |
37918772 |
T |
|
| Q |
187 |
tgttaaaaattgcatagtataaaa-tccttcactaatcaccctctccctttcccatatcttcgggagcctagatcttacccaaagcaaatggctcatcta |
285 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37918771 |
tgttaaaaattgcatagtataaaaatccttcactaatcaccctctccctttcccatatcttcgggagcctagatcttacccaaagcaaatggctcatcta |
37918672 |
T |
|
| Q |
286 |
atgtacttgcgttatagaaaggtactccta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37918671 |
atgtacttgcgttatagaaaggtactccta |
37918642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 363 - 408
Target Start/End: Complemental strand, 37918588 - 37918543
Alignment:
| Q |
363 |
gtggtccgaacctctactccagagcaacacacacttgtctatccat |
408 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37918588 |
gtggtccgaacctcaactccagagcaacacacacttgtctatccat |
37918543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University