View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_31 (Length: 241)
Name: NF2966_low_31
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29274033 - 29274258
Alignment:
| Q |
1 |
ttagatactgaatagagttacttggccgatgctctttaaaatccatgttagggcttatcgtgttcttgatcatatcattcctccttcaaagaatgataag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29274033 |
ttagatactgaatagggttacttggccgatgctctttaaaatccatgttagggcttatcgtgttcttgatcatacaattcctccttcaaagaatgataag |
29274132 |
T |
|
| Q |
101 |
aagtcgatttcatgtctttgatgt--ttgtgtttacagtggatttacggcactatctcttgcgatcctcccaacacaatcattgaacgtgattcaaccac |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29274133 |
aagtcgatttcatgtctttgatgttgttgtgtttacagtggatttacggcactatctcttgcgatcttcccaacacaatcattgaacgtgattcaaccac |
29274232 |
T |
|
| Q |
199 |
cgaacttgcatgaaacatgttttggt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29274233 |
cgaacttgcatgaaacatgttttggt |
29274258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University