View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2966_low_35 (Length: 236)
Name: NF2966_low_35
Description: NF2966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2966_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 76 - 217
Target Start/End: Complemental strand, 37918005 - 37917864
Alignment:
| Q |
76 |
gcaccgcctagtcatacattggaagaacaagaagaagatgaagatgatgattttgtttcactttcagagttcaaagatctaccaaacagatttcaccgca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37918005 |
gcaccgcctagtcatacattggaagaacaagaagaagatgaagatgatgattttgtttcactttcagagttcaaagatctaccaaacagatttcaccgca |
37917906 |
T |
 |
| Q |
176 |
cactacttccagacctagaaagaatctcaacaacctcaaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37917905 |
cactacttccagacctagaaagaatctcaacaacctcaaaag |
37917864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University