View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2968_high_5 (Length: 297)
Name: NF2968_high_5
Description: NF2968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2968_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 11 - 204
Target Start/End: Original strand, 29091685 - 29091880
Alignment:
| Q |
11 |
aatgtgatgggaatggtgcagctccacgtgatgcacttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29091685 |
aatgtgatgggaatggtgcagctccacctacttcacttttcgagattacaattggacaaggtgatcaacaagattactatgatgttagtatggttgatgg |
29091784 |
T |
|
| Q |
111 |
atgcaatcttccaatgcttgttctacca--aggtgtatatggtaatagtgcatgtaatgccgcaggttgtgtgactgatattaacagaggtatgag |
204 |
Q |
| |
|
|| |||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29091785 |
atacaatctcccaatgcttgttctaccaagaggtgtatatggtaaaagtgcatgtaatgccacaggttgtgtgactgatattaacagaggtatgag |
29091880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 132
Target Start/End: Original strand, 29084346 - 29084467
Alignment:
| Q |
11 |
aatgtgatgggaatggtgcagctccacgtgatgcacttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29084346 |
aatgtgatgggaatggtgcagctccacgtgatggacttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatgg |
29084445 |
T |
|
| Q |
111 |
atgcaatcttccaatgcttgtt |
132 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29084446 |
atgcaatcttccaatgcttgtt |
29084467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University