View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2968_high_6 (Length: 263)
Name: NF2968_high_6
Description: NF2968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2968_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 40734031 - 40733802
Alignment:
| Q |
18 |
aattttcccctttcagcatcactgtcgccaagcgacaattctgaaacaaatccaaattcttccgaaatgaaggaagcatttgtccatggggtaggtttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40734031 |
aattttcccctttcagcatcactgtcgccaagcgacaattctgaaacaaatccaaattcttccgaaatgaaggaagcatttgtccatggggtaggtttta |
40733932 |
T |
 |
| Q |
118 |
cttaattaactcgtgttaatttgtatgcatttttatggcaaaaactctttttaggttaatcttgttgcgataatggatctataattgtttggaatgcaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40733931 |
cttaattaactcgtgttaatttgtatgcatttttatggcaaaaactctttttaggttaatcttgttgcgataatggatctataattgtttggaatgcaat |
40733832 |
T |
 |
| Q |
218 |
ggatcacatgatcaagggcttgtttctagg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
40733831 |
ggatcacatgatcaagggcttatttctagg |
40733802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University