View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2968_low_10 (Length: 219)
Name: NF2968_low_10
Description: NF2968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2968_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 39278304 - 39278491
Alignment:
| Q |
18 |
ttttcttataaaattttatgtttt-ttgggacatgtttgatgacaacaggtaatggtgaaatcgttaaagagggtagtaaacctgtgaaagttaatgctg |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39278304 |
ttttcttataaaattttatgtttttttgggacatgtttgatgacaacaggtaatagtgaaatcgttaaagagggtagtaaacctgtgaaagttaatgctg |
39278403 |
T |
 |
| Q |
117 |
cagagatgaagctgcagacaattgagcaacaacgaaatattttgacaatgctagagaaatctttggcaaaagaaagggatcttgagaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39278404 |
cagagatgaagctgcagacaattgagcaacaacgaaatattttgacaatgctagagaaatctttggcaaaagaaagggatcttgagaa |
39278491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University