View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_high_22 (Length: 248)
Name: NF2970_high_22
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 46723672 - 46723572
Alignment:
| Q |
1 |
tcacatcaaccttgtttccacacaggacaatgggtatattctcacacacactgattattaacaagaatttaagagtcccaaattagtaagctgaaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46723672 |
tcacatcaaccttgtttccacacaggacaatgggtatattctcacacacactgattattaacaagaatttaagagtcccaaattagtaagctgaaaaatt |
46723573 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
46723572 |
g |
46723572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 139 - 232
Target Start/End: Complemental strand, 46723578 - 46723485
Alignment:
| Q |
139 |
aaaattgatgaaatcagtgaactgaccgagtgatatctctgtgccatgttggaacatttttgtatgtcaaacgagcagttacatcgaacataat |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46723578 |
aaaattgatgaaattagtgaactgaccgagtgatatctccgtgccatgtcggaacatttttgtatgtcaaacgagcagttacatcgaacataat |
46723485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University