View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_high_27 (Length: 234)
Name: NF2970_high_27
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_high_27 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 2310052 - 2310271
Alignment:
| Q |
15 |
tttttaccttatatatctggcacatgttttgctaatgagaagataggtctaagctgggatttggttaagccttttccaagtgatgcagagaaagcaacct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2310052 |
tttttaccttatatatctggcacatgttttgctaatgggaagataggtctaagctgggatttggttaagccttttccaagtgatgcagagaaagcaacct |
2310151 |
T |
|
| Q |
115 |
taattgcacatgaggtattttatgattttgttttgtctaactctttgtttttatagtaaactactacctggttttaaattgcggccgcgattgcggattc |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2310152 |
taattgcacgtgaggtattttatgattttgttttgtctaactctttgtttttatagtaaactactacctggttttaaattgcggccgcgattgcggattc |
2310251 |
T |
|
| Q |
215 |
attgtgactcttgatattac |
234 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
2310252 |
attgtaactcttgatattac |
2310271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 38 - 233
Target Start/End: Complemental strand, 2928963 - 2928767
Alignment:
| Q |
38 |
atgttttgctaatgagaagataggtctaagctgggatttggttaagccttttccaagtgatgcagagaaagcaaccttaattgcacatgaggtattttat |
137 |
Q |
| |
|
||||||| | |||| |||||||| |||||||||||||||| ||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2928963 |
atgttttcccaatgggaagatagttctaagctgggatttgattaggcattttccaagtgatgcagagaaagcaactataattgcacatgaggtattttat |
2928864 |
T |
|
| Q |
138 |
ga-ttttgttttgtctaactctttgtttttatagtaaactactacctggttttaaattgcggccgcgattgcggattcattgtgactcttgatatta |
233 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
2928863 |
gacttttgttttgtctaactctttgtttttatagtaaactactacctggttttaaattgtggccgcgattgcgaattcattgtgactcttgacatta |
2928767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University