View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_high_7 (Length: 339)
Name: NF2970_high_7
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 181 - 323
Target Start/End: Complemental strand, 16927021 - 16926879
Alignment:
| Q |
181 |
aacatcaaccagatttccatctatctataagactagatggccctggcccaccatctctacttttaggtccaccatgaatctcacctggaataacaatact |
280 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16927021 |
aacatccaccagatttccatctatctataagaccagatggccctggcccaccatctctacttttaggtccaccatgaatctcacctggaataacaatatt |
16926922 |
T |
|
| Q |
281 |
catgctatttgaataatccttattttttccaccataacattca |
323 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16926921 |
catgctatttgaataatcctcattttttccaccataacattca |
16926879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 16927112 - 16927018
Alignment:
| Q |
14 |
agagaacaaggataaactactacatattgaagattaactaacctgagaaactatatcaagtgtcttgcagtctccatgctcatcttcttggaaca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16927112 |
agagaacaaggataaactactacatattgaagattaacttacctgagaaactatatcaagtgtcttgcagtctccatgctcatcttcttggaaca |
16927018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University