View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_low_18 (Length: 257)
Name: NF2970_low_18
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 2310262 - 2310502
Alignment:
| Q |
1 |
ttgatattacactaaaattcaggtaaatgtagtcaattgcggatgtgacgtttttgtagaaaattttaatatattgtgaccgcatttccagttgtggacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2310262 |
ttgatattacactaaaattcaggtaaatgtagtcaattgcggttgtgacgtttttgtagaaaattttaatatattgtgactgcatttccagttgtggacc |
2310361 |
T |
 |
| Q |
101 |
gcaatttaattctatgatttaatatggataggtatcaggtcttagaggccctagagcttataccatatagcttgctaatttcagctaatgataatagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2310362 |
gcaatttaattctatgatttaatatggataggtctcaggtctcagaggccctagagcttataccatataacttgctaatttcagctaatgataatagaga |
2310461 |
T |
 |
| Q |
201 |
ctaatcagtttatgttggttttcgtgttaattagattgcgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2310462 |
ctaatcagtttatgttggttttcgtgttaattaggttgcgc |
2310502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 2928775 - 2928657
Alignment:
| Q |
1 |
ttgatattacactaaaattcaggtaaatgtagtcaattgcggatgtgacgtttttgtagaaaattttaa-----tatattgtgaccgcatttccagttgt |
95 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||||||| ||||| ||||||||| |||||| ||| |||||| |||||||| || ||||||| |
|
|
| T |
2928775 |
ttgacattatactaaaatgcaggtaaatgtagtcaattgcggttgtgatgtttttgtaaaaaattataatattttatattatgaccgcacttgcagttgt |
2928676 |
T |
 |
| Q |
96 |
ggaccgcaatttaattcta |
114 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
2928675 |
ggaccgtaatttaattcta |
2928657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 171 - 241
Target Start/End: Complemental strand, 2928638 - 2928564
Alignment:
| Q |
171 |
cttgctaatttcagctaatga----taatagagactaatcagtttatgttggttttcgtgttaattagattgcgc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2928638 |
cttgctaatttcagctaatgaatgataatagagacttattggtttatgttggttttcgtgttaattaggttgcgc |
2928564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University