View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_low_3 (Length: 457)
Name: NF2970_low_3
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 1956779 - 1956853
Alignment:
| Q |
14 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa |
88 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1956779 |
gagaagaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa |
1956853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 373 - 441
Target Start/End: Original strand, 1956962 - 1957030
Alignment:
| Q |
373 |
catattatggatttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaag |
441 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1956962 |
catattatggatttgattaaattttcatgcactttgaaggaggctagaggctgataggtttttcacaag |
1957030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 1941688 - 1941761
Alignment:
| Q |
14 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa |
87 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| | || |||||| |||||||||| |||||||| |
|
|
| T |
1941688 |
gagaagaagataaagggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa |
1941761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 14 - 136
Target Start/End: Original strand, 1927578 - 1927701
Alignment:
| Q |
14 |
gagatgaagataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaaat-actaaaacttgttttgttttat |
112 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||| ||||| ||||| ||| |||||||||| ||||||||||| | | | | || |||| |||||| |
|
|
| T |
1927578 |
gagaagaagataaagggttttgcaataagtgaaacagcttttacaatatttcttctcatggcatctaggtaaaaaataaattacaattattttattttat |
1927677 |
T |
 |
| Q |
113 |
ttatgtttataccttcataatatt |
136 |
Q |
| |
|
| |||||| ||||||||||||||| |
|
|
| T |
1927678 |
tgatgtttttaccttcataatatt |
1927701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 441
Target Start/End: Original strand, 1942053 - 1942111
Alignment:
| Q |
383 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaag |
441 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
1942053 |
atttgattgaactttaatgcactttgcaggaggctagagggtgatagatttttcacaag |
1942111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 441
Target Start/End: Original strand, 1928076 - 1928134
Alignment:
| Q |
383 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaag |
441 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| | |||||| ||||||||||| |
|
|
| T |
1928076 |
atttgattgaactttaatgcactttgtaggaggctagaaggtgatagatttttcacaag |
1928134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 291 - 334
Target Start/End: Original strand, 36774869 - 36774912
Alignment:
| Q |
291 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774869 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
36774912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University