View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2970_low_6 (Length: 400)
Name: NF2970_low_6
Description: NF2970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2970_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 369661 - 369435
Alignment:
| Q |
19 |
tgactatgatggatggataatagattcgggtgcaatggactacacggcgtatgagtcgagtggctttatcaattctacaccttcaaggagaactagtatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369661 |
tgactatgatggatggataatagattcgggtgcaatggactacacggcgtatgagccgagtggctttatcaattctacaccttcaaggagaactagtatt |
369562 |
T |
|
| Q |
119 |
aatttttagttacaatggtgttatatatgcagttacaaaagctgcaactgttgctctttcacattctatttcattgtcacacttgacttgttccatcttt |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369561 |
aatttttagttataatggtgttatatatgcagttacaaaagctgcaactgttgctctttcacattctatttcattgtcacacttgacttgttccatcttt |
369462 |
T |
|
| Q |
219 |
gtcaaacaaattagcgcctattggcca |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
369461 |
gtcaaacaaattagcgcctattggcca |
369435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 252 - 388
Target Start/End: Complemental strand, 365920 - 365783
Alignment:
| Q |
252 |
ttttcttcatgatattctcaccaagaaaatcattagtcattgtactaaaaa-ggtgggttgtattatatggatgatttcaacatacgcagaaccacctat |
350 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
365920 |
ttttcttcatgatattctcaccaaggaaatcattagtcattgtactaaaaaaggtgggttgtattatatggatgatttcaacatacgcagaaccaactat |
365821 |
T |
|
| Q |
351 |
aggcaaaattctctagatataaagcataaacatatttt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365820 |
aggcaaaattctctagatataaagcataaacatatttt |
365783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University