View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2971_low_1 (Length: 505)
Name: NF2971_low_1
Description: NF2971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2971_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 23 - 496
Target Start/End: Complemental strand, 38096951 - 38096486
Alignment:
| Q |
23 |
atcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcactnnnnnnnnttttgcctccctcttttcctcttttgtttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38096951 |
atcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcactccccc---ttttgcctccctcttttcctcttttgtttc |
38096855 |
T |
 |
| Q |
123 |
ctttaacttcacctcatccatccctagcctgcttctcctgtaagaaaacaaaaggtaacaaattaaacaacaaataaaagaaattctataagtaattaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
38096854 |
ctttaacttcacctcatccatccctagcctgcttctcctgtaagaaaacaaaaggtaacat-ttaaacaacaaataaaagaaattctaaaagtaat---- |
38096760 |
T |
 |
| Q |
223 |
gagaaacgtacctttcttcattataggaattagatttcttgagcacaggttcagcttgaaaagcaacccggtttgctttcatggattccacaatactccc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096759 |
gagaaacgtacctttcttcattataggaattagatttcttgagcacaggttcagcttgaaaagcaacccggtttgctttcatggattccacaatactccc |
38096660 |
T |
 |
| Q |
323 |
actaaagtattccttctcttcactctgcaaattccccatcaaccttggattctccgttacacatatatcttcatcaccagaatacactttctcttcatca |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096659 |
actaaagtattccttctcttcactctgcaaattccccatcaaccttggattctccgttacacatatatcttcatcaccagaatacactttctcttcatca |
38096560 |
T |
 |
| Q |
423 |
acactctcccttcttttgcttgtggtccccacattgctcagcctcccttcctgctgctttgctttcatctctgc |
496 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096559 |
acactctcccttctcttgcttgttgtccccacattgctcagcctcccttcctgctgctttgctttcatctctgc |
38096486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University