View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_high_1 (Length: 576)
Name: NF2972_high_1
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 16007992 - 16008095
Alignment:
| Q |
7 |
tgagaagaaaaaattcaaaatactcacgctctatttttt-cggnnnnnnnn--tacaataatttcaatcaaatatcactgaataagttctagaaaataat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16007992 |
tgagaagaaaaaattcaaaatactcacgctctatttttttcggaaaaaaaaaatacaataatttcaatcaaatatcacttaataagttctagaaaataat |
16008091 |
T |
|
| Q |
104 |
ttta |
107 |
Q |
| |
|
|||| |
|
|
| T |
16008092 |
ttta |
16008095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University