View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_high_19 (Length: 247)
Name: NF2972_high_19
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 12 - 130
Target Start/End: Original strand, 43383170 - 43383282
Alignment:
| Q |
12 |
gagatgaaaggtggagataaaaattggtccgatgatcatagtagtggtgatcaatacaggatgaaagatgattctgttaatgttactggtaagaagaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
43383170 |
gagatgaaaggtggagataaaaattggtccgatgatcatagtagtggtgatcaatacaggatgaaagatga------tactgttactggtaagaagaaga |
43383263 |
T |
 |
| Q |
112 |
gtaaggaattgggtgggga |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43383264 |
gtaaggaattgggtgggga |
43383282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 43383301 - 43383373
Alignment:
| Q |
158 |
gaacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383301 |
gaacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatg |
43383373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 159 - 230
Target Start/End: Original strand, 25870023 - 25870094
Alignment:
| Q |
159 |
aacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870023 |
aacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatg |
25870094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 25869933 - 25869970
Alignment:
| Q |
12 |
gagatgaaaggtggagataaaaattggtccgatgatca |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869933 |
gagatgaaaggtggagataaaaattggtccgatgatca |
25869970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 25869981 - 25870009
Alignment:
| Q |
102 |
aagaagaagcgtaaggaattgggtgggga |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25869981 |
aagaagaagcgtaaggaattgggtgggga |
25870009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University