View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_high_26 (Length: 213)
Name: NF2972_high_26
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 46905334 - 46905514
Alignment:
| Q |
19 |
tttatagggtacgttcctttaatatggatatgatcttaacacgaataacattgttgaatttccttaaaataaaaatgttgaattggtaatagtaatttat |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46905334 |
tttatagggtacgttgctttaatatggatatgatcttaacacgaataacattgttgaatttccttaaaataaaaatgttgaattggtaatagtaatttat |
46905433 |
T |
|
| Q |
119 |
ttatttttgaattattattggtaatagattaagttaattatcacactatcacatttaagatcatggttaatttagaattat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46905434 |
ttatttttgaattattattggtaatagattaagttaattatcacactatcacatttaagatcatggttaatttggaattat |
46905514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University