View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_high_27 (Length: 209)
Name: NF2972_high_27
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_high_27 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 38 - 209
Target Start/End: Original strand, 9182503 - 9182674
Alignment:
| Q |
38 |
ttgtttcattttactctttcaggtgataatggtgagaattacagagcgagtagtcagtacttactttgccagattgtaccttagccaggtattgacaact |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9182503 |
ttgtttcattttactctttcaggtgataatggtgagaattacagagcgagtagtcagtacttactttgccagattgtaccttagccaggtattgacaact |
9182602 |
T |
 |
| Q |
138 |
tttaaaagataaatgcctttttgttatgcttttttattcgtaaaagtgctcatcaaagtttataattccttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9182603 |
tttaaaagataaatgcctttttgttatgcttttttattcgtaaaagtgctcatcaaagtttataattccttc |
9182674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 9186352 - 9186315
Alignment:
| Q |
7 |
taagtattgagatcatggataatcttcttttttgtttc |
44 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
9186352 |
taagtattgagatcatgaataatcttattttttgtttc |
9186315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University