View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_low_19 (Length: 250)
Name: NF2972_low_19
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 21484926 - 21484707
Alignment:
| Q |
1 |
tcaagagacataatattgatacaagggatcaaaattgttcgacaagttatgatggaagacaatgactatttatttcttaactgtga-nnnnnnncttgtt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21484926 |
tcaagagacataatattgatacaagggatcaaaattgttcgacaagttatgatggaagacaatgactatttatttcttaactgtgattttttttcttgtt |
21484827 |
T |
|
| Q |
100 |
gtagattacggtcgttaaattggtcgggtttatcaaaggctcttcaaggtaatgtttaggatcannnnnnnngcagtttggttatttagggggttttcaa |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
21484826 |
gtagattacggtcgttaaattggccgggtttatcgatggctcttcaaggtaatgtttaggatcattttttttgcagtttggttattttgggggttttcaa |
21484727 |
T |
|
| Q |
200 |
aaaatgttcatttaacactt |
219 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
21484726 |
aaaatgtttgtttaacactt |
21484707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University