View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_low_26 (Length: 226)
Name: NF2972_low_26
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 221
Target Start/End: Original strand, 37756344 - 37756558
Alignment:
| Q |
7 |
cataagtcatttgtgtccttaaatgatgcatcatcctagtggatcatgactgctgctggcactcccatgccactagcaggcattgggtctgtctccacaa |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37756344 |
cataagtcatttgtgttcttaaatgatgcatcatccaagtggatcatgactgctgctggcactcccatgccactagcaggcattgggtctgtctccacaa |
37756443 |
T |
 |
| Q |
107 |
ctatcttgtcttctttactgatgtttactatattcctaacctcactttgagtcttattagggatcttggcacaacaattagagtgcatgttagttttgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37756444 |
ctatcttgtcttctttactgatgtttactatattcctaacctcactttgagtcttattagggatcttggcacaacaattagagtgcatgttagttttgtt |
37756543 |
T |
 |
| Q |
207 |
attacaagcatccaa |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37756544 |
attacaagcatccaa |
37756558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 161
Target Start/End: Complemental strand, 47632736 - 47632629
Alignment:
| Q |
52 |
atgactgctgctggcactcccatgccactagcaggcattgggtctgtctccacaactatcttgtcttctttactgatgtttactatattcctaacctcac |
151 |
Q |
| |
|
|||||||||| |||||| || |||||| ||||||||||||| || ||||| || ||| |||||| ||| | || ||||||| |||||||||| || || |
|
|
| T |
47632736 |
atgactgctgatggcacccctatgccattagcaggcattggttcggtctctacctctaacttgtc-tctct-ctaatgtttatcatattcctaaacttac |
47632639 |
T |
 |
| Q |
152 |
tttgagtctt |
161 |
Q |
| |
|
|||||||||| |
|
|
| T |
47632638 |
tttgagtctt |
47632629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University