View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2972_low_27 (Length: 224)
Name: NF2972_low_27
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2972_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 37223921 - 37223734
Alignment:
| Q |
18 |
attagcaaccgttattgcgccatccttggacactgtggttgaaccagcttccgagctactggacaatgaaagtaatcctgcagcatatgttgggatgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223921 |
attagcaaccgttattgcgccatccttggacactgtggttgaaccagcttccgagctactagacaatgaaagtaatcctgcagcatatgttgggatgaaa |
37223822 |
T |
|
| Q |
118 |
catatagattatatgaaacttcaacgaaacaaccagctttacgggaaatctgtgctaaacaaagtgaaaatatgattttgaatcacct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223821 |
catatagattatatgaaacttcaacgaaacaaccagctttacgggaaatctgtgctaaacaaagtgaaaatatgattttgaatcacct |
37223734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University