View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2972_low_29 (Length: 209)

Name: NF2972_low_29
Description: NF2972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2972_low_29
NF2972_low_29
[»] chr5 (2 HSPs)
chr5 (38-209)||(9182503-9182674)
chr5 (7-44)||(9186315-9186352)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 38 - 209
Target Start/End: Original strand, 9182503 - 9182674
Alignment:
38 ttgtttcattttactctttcaggtgataatggtgagaattacagagcgagtagtcagtacttactttgccagattgtaccttagccaggtattgacaact 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9182503 ttgtttcattttactctttcaggtgataatggtgagaattacagagcgagtagtcagtacttactttgccagattgtaccttagccaggtattgacaact 9182602  T
138 tttaaaagataaatgcctttttgttatgcttttttattcgtaaaagtgctcatcaaagtttataattccttc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9182603 tttaaaagataaatgcctttttgttatgcttttttattcgtaaaagtgctcatcaaagtttataattccttc 9182674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 9186352 - 9186315
Alignment:
7 taagtattgagatcatggataatcttcttttttgtttc 44  Q
    ||||||||||||||||| |||||||| |||||||||||    
9186352 taagtattgagatcatgaataatcttattttttgtttc 9186315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University