View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2973_low_4 (Length: 284)
Name: NF2973_low_4
Description: NF2973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2973_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 21641317 - 21641585
Alignment:
| Q |
1 |
atcaaatttggcttttaatatggtatcttatgggtccaatgggaaaatatatgtgaaggtaacgcgtttagaacatgtgacatacattataattt-cgtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21641317 |
atcaaatttggcttttaatatggtatcttatgggtccaatgggaaaatatatgtgaaggtaacgcgtttagaacatgtgacatacattataattttcgtg |
21641416 |
T |
 |
| Q |
100 |
cctacttttccacttgnnnnnnnnnnnnnnnnnntgggcacacaaaccgttactcttcaaatttcaagataccatcctcttctttagttttctatattca |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641417 |
cctacttttccacttgtatatatataatatat--tgggcacacaaaccgttactcttcaaatttcaagataccatcctcttctttagttttctatattca |
21641514 |
T |
 |
| Q |
200 |
tcttctagtggatttcaattacaatctcaaagattagtgattgaaaaatttggttagattttgttgaactt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641515 |
tcttctagtggatttcaattacaatctcaaagattagtgattgaaaaatttggttagattttgttgaactt |
21641585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University